Antibiotic Resistance Gene-Carrying Plasmid Spreads into the Plant Endophytic Bacteria using Soil Bacteria as Carriers

Functions of animal manure and handled wastewater may enrich antibiotic-resistant micro organism (ARB) and antibiotic resistance genes (ARGs) within the plant microbiome. Nonetheless, the mechanistic research of the transmission of ARB and ARGs from the surroundings to plant endophytic micro organism had been few. Herein, a genetically engineered fluorescent Escherichia coli harboring a conjugative RP4 plasmid that carries three ARGs was used to hint its unfold into Arabidopsis thaliana inside in a tetracycline-amended hydroponic system within the absence or presence of a simulated soil bacterial group. Confocal microscope commentary demonstrated that E. coli was internalized into plant tissues and the carried RP4 plasmid was transferred into plant endophytic micro organism.

Extra importantly, we noticed that soil micro organism inhibited the internalization of E. coli however considerably promoted RP4 plasmid unfold into the plant microbiome. The altered RP4-carrying bacterial group composition within the plant microbiome and the elevated core-shared RP4-carrying micro organism quantity between plant inside and exterior within the presence of soil micro organism collectively confirmed that soil micro organism, particularly Proteobacteria, would possibly seize RP4 from E. coli after which translocate into plant microbiome, ensuing within the elevated RP4 plasmid unfold within the plant endophytes. General, our findings offered essential insights into the dissemination of ARB and ARGs from the surroundings to the plant microbiome.

Small-scale GMP manufacturing of plasmid DNA utilizing a simplified and totally disposable manufacturing methodology

Prior to now years, the demand for small batches of medical grade plasmid DNA has been rising. For that objective, we designed and certified a scaled-down Good Manufacturing Practices (GMP) manufacturing methodology, in a position to produce small batches (1-Four mg) of plasmid. The developed methodology doesn’t require any complicated manufacturing gear and makes use of solely disposable manufacturing supplies, which makes it straightforward to implement and simplifies line-clearance. Now we have efficiently used this methodology to provide a number of small batches of two completely different plasmids. The produced plasmids, each formulated in an Electroporation Buffer, are combined and stuffed into small, single-use, aliquots.

High quality management confirmed the robustness of the developed methodology and a stability examine confirmed that the ultimate formulation is secure for at the least two years. The ultimate affected person formulation might be subsequently utilized in a part I/II medical trial through which retina cells of sufferers with Age Associated Macular Degeneration, are transfected. The introduced manufacturing methodology will be generically used for different plasmid constructs and ultimate formulation designs.

Operate and distribution of the conjugative plasmid pLM1686 in foodborne Listeria monocytogenes in China

Listeria monocytogenes, a deadly foodborne pathogen has the extraordinary capability to outlive in harsh situations and is a possible risk to public well being. A novel 91 kb plasmid pLM1686 was discovered within the prevalent L. monocytogenes sequence sort (ST) 87 pressure in China. On this examine, the perform and distribution of pLM1686 had been firstly investigated in L. monocytogenes. The outcomes confirmed plasmid pLM1686 had self-transmissible capability and existed in numerous sorts of L. monocytogenes isolates belonging to 2 lineages (lineage I and II), 4 serotypes (1/2b, 3b, 1/2c and 1/2a) and 4 STs (ST87, ST59, ST9 and ST120).

The wild pressure LM1686 and transconjugant pressure 10403S_P1686 exhibited considerably larger development price and biofilm formation in Modification of Welshimer’s medium (MWB), higher salinity tolerance, stronger cell invasion and better cytotoxicity than plasmid-cured pressure and reference pressure 10403S. Furthermore, plasmid curing prompted the lack of cadmium resistance of pressure, and the recipient pressure acquired cadmium resistance after conjugation. Thus, pLM1686 would supply L. monocytogenes benefits of surviving in adversarial environments.

heraeus-targets

Intramuscular Expression of Plasmid-Encoded FVII-Fc Immunoconjugate for Tumor Immunotherapy by Concentrating on Tumoral Blood Vessels and Cells

Tissue issue (TF) has been confirmed to be particularly expressed by vascular endothelial cells (VECs) in strong tumors and sure sorts of malignant tumor cells. Coagulation issue VII (FVII) can particularly bind to TF with excessive affinity, so the FVII-TF interplay gives an best goal for tumor remedy. Expression of proteins in skeletal muscular tissues is an easy and economical avenue for steady manufacturing of therapeutic molecules. Nonetheless, it’s tough to deal with strong tumors until now because of the restricted variety of therapeutic proteins produced by the intramuscular gene expression system. Herein, we strived to discover whether or not anti-tumor results will be achieved by way of intramuscular supply of a plasmid encoding a FVII-guided immunoconjugate (Icon) molecule by a beforehand established Pluronic L64/electropulse (L/E) approach.

Our examine exhibited a number of fascinating outcomes. 1) The mouse mild chain of FVII (mLFVII) molecule may information crimson fluorescent protein (RFP) to build up predominantly at tumor websites in a TF-dependent method. 2) Intramuscular expression of mLFVII-hFc (human IgG1 Fc) Icon may considerably inhibit the expansion of each liver and lung cancers in nude mice, and the inhibition extent was proportional to the extent of tumor-expressed TF. 3) The variety of blood vessels and the quantity of blood movement in tumors had been considerably decreased in mLFVII-hFc Icon-treated mice. 4) This immunotherapy system didn’t show apparent unintended effects. Our examine offered an environment friendly and economical system for tumor immunotherapy by focusing on each blood vessels and tumor cells. Additionally it is an open system for synergistic remedy by conveniently integrating different anticancer regimens.

Enterococcal PrgU Offers Further Regulation of Pheromone-Inducible Conjugative Plasmids

Environment friendly horizontal gene switch of the conjugative plasmid pCF10 from Enterococcus faecalis will depend on the expression of its sort Four secretion system (T4SS) genes, managed by the P_Q promoter. Transcription from the P_Q promoter is tightly regulated, partially to restrict cell toxicity brought on by overproduction of PrgB, a T4SS adhesin. PrgU performs an essential function in regulating this toxicity by lowering PrgB ranges. PrgU has an RNA-binding fold, prompting us to check whether or not PrgU exerts its regulatory management by way of binding of prgQ transcripts. We used a mixture of in vivo strategies to quantify PrgU results on prgQ transcripts at each single-cell and inhabitants ranges. PrgU perform requires a selected RNA sequence inside an intergenic area (IGR) about 400 bp downstream of P_Q. PrgU interplay with the IGR reduces ranges of downstream transcripts. Single-cell expression evaluation confirmed that cells expressing prgU decreased transcript ranges extra quickly than isogenic prgU-minus cells. PrgU sure RNA in vitro with out sequence specificity, suggesting that PrgU requires a selected RNA construction or a number of host components for selective binding in vivo.

PrgU binding to its IGR goal would possibly recruit RNase(s) for focused degradation of downstream transcripts or scale back elongation of nascent transcripts past the IGR. IMPORTANCE Micro organism make the most of sort Four secretion techniques (T4SS) to effectively switch DNA between donor and recipient cells, thereby spreading genes encoding antibiotic resistance in addition to numerous virulence components. Regulation of expression of the T4SS proteins and floor adhesins in Gram-positive micro organism is essential, as a few of these are extremely poisonous to the cell. The significance of our analysis lies in figuring out the novel mechanism by which PrgU performs its delicate fine-tuning of the expression ranges. As prgU orthologs are current in numerous conjugative plasmids and transposons, our outcomes are seemingly related to understanding of various clinically essential switch techniques.

Recombinant Human Non-specific lipid-transfer protein Protein, GST, E.coli-10ug
QP6653-ec-10ug	EnQuireBio	10ug	EUR 240

SARS-CoV-2 Nucleocapsid Protein, Avi-His-tag
E80027	EpiGentek	EUR 635.80 EUR 4087.60	1 ml 100 ul

Recombinant SARS-CoV-2 Spike Glycoprotein(S) (D614G), Partial
E80028	EpiGentek	EUR 388.30 EUR 860.20	20 ul 100 ul

SARS-CoV-2 Spike S1 RBD Protein, Avi-His-tag
E80024	EpiGentek	EUR 635.80 EUR 4995.10	100 ul 1 ml

SARS-CoV-2 Spike S1 RBD Protein, Mouse Fc-fusion
E80026	EpiGentek	EUR 588.50 EUR 823.90	20 ul 50 ul

SARS-CoV-2 Spike S1 (16-685) Protein, Avi-His-tag
E80021	EpiGentek	EUR 635.80 EUR 4276.80	100 ul 1 ml

SARS-CoV-2 Spike S1 RBD (V367F) Protein, Avi-His-tag
E80023	EpiGentek	EUR 635.80 EUR 3934.70	100 ul 1 ml

SARS-CoV-2 Spike S1 (13-665) Protein, Fc Fusion, Avi-tag
E80020	EpiGentek	EUR 635.80 EUR 4276.80	100 ul 1 ml

SARS-CoV-2 Spike S1 (16-685) Protein, Fc Fusion, Avi-tag
E80022	EpiGentek	EUR 635.80 EUR 4276.80	100 ul 1 ml

SARS-CoV-2 Spike S1 RBD Protein, Human Fc-Fusion, Avi-Tag
E80025	EpiGentek	EUR 635.80 EUR 3934.70	100 ul 1 ml

pLenti-CARM1 shRNA-2 Plasmid
PVTBAV03691-2	Lifescience Market	2 ug	EUR 427.2

pLenti-CTLA4 shRNA-2 Plasmid
PVTBAV05689-2	Lifescience Market	2 ug	EUR 427.2

pLenti-FOXM1 shRNA-2 Plasmid
PVTBAV08732-2	Lifescience Market	2 ug	EUR 427.2

pLenti-JUN shRNA-2 Plasmid
PVTBAV11741-2	Lifescience Market	2 ug	EUR 427.2

pLenti-LHX6 shRNA-2 Plasmid
PVTBAV12881-2	Lifescience Market	2 ug	EUR 427.2

pLenti-MAGEA3 shRNA-2 Plasmid
PVTBAV13661-2	Lifescience Market	2 ug	EUR 427.2

pLenti-RUNX3 shRNA-2 Plasmid
PVTBAV20583-2	Lifescience Market	2 ug	EUR 427.2

pLenti-Slc7a11 shRNA-2 Plasmid
PVTBAV21973-2	Lifescience Market	2 ug	EUR 427.2

pLenti-STAT3 shRNA-2 Plasmid
PVTBAV22921-2	Lifescience Market	2 ug	EUR 427.2

pLenti-XRCC5 shRNA-2 Plasmid
PVTBAV26238-2	Lifescience Market	2 ug	EUR 427.2

Recombinant Transmembrane Protease Serine 2 Protein, Partial
E80016	EpiGentek	EUR 470.80 EUR 753.50 EUR 1824.90	20 ul 100 ul 500 ul

Recombinant Porcine IL 2 Protein, Untagged, E.coli-10ug
QP10699-10ug	EnQuireBio	10ug	EUR 241.2

Recombinant Canine MCP 2 Protein, Untagged, E.coli-10ug
QP10782-10ug	EnQuireBio	10ug	EUR 241.2

Recombinant Human BMP-2 Protein, Untagged, E.coli-10ug
QP5363-10ug	EnQuireBio	10ug	EUR 284.4

Recombinant HIV-2 Protease Protein, Untagged, E.coli-10ug
QP12271-10ug	EnQuireBio	10ug	EUR 241.2

Recombinant Human Glutaredoxin-2, GST, E.coli-10ug
QP8154-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human Arginase-2, GST, E.coli-10ug
QP5676-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human CXCL2/ MIP-2 Protein, Untagged, E.coli-10ug
QP1016-10ug	EnQuireBio	10ug	EUR 284.4

Recombinant Influenza Parainfluenza Type-2 Protein, Untagged, E.coli-10ug
QP12960-10ug	EnQuireBio	10ug	EUR 186

Recombinant Human STC 2 Protein, Untagged, HEK 293-10ug
QP13613-10ug	EnQuireBio	10ug	EUR 241.2

Recombinant Bovine FGF 2 Protein, Untagged, Native Protein-10ug
QP10599-10ug	EnQuireBio	10ug	EUR 426

Recombinant Human MMP-2 Protein, His, HEK 293-10ug
QP10790-10ug	EnQuireBio	10ug	EUR 241.2

Recombinant Mouse MCP-2/ CCL8 Protein, Untagged, E.coli-10ug
QP5471-10ug	EnQuireBio	10ug	EUR 284.4

ACE2, His-Tag Protein
E80019	EpiGentek	EUR 612.70 EUR 1437.70	20 ul 100 ul

KRTAP3-2 cloning plasmid
CSB-CL871617HU-10ug	Cusabio	10ug	EUR 279.6
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 297 Sequence: atggattgctgtgcctctcgcagctgcagtgtccccactgggcctgccaccaccatctgctcctccgacaaatcctgccgctgtggagtctgcctgcccagcacctgcccacacacagtttggttactggagcccatctgctgtgacaactgtcccccaccctgccacattcctca Show more
Description: A cloning plasmid for the KRTAP3-2 gene.

KRTAP9-2 cloning plasmid
CSB-CL880139HU1-10ug	Cusabio	10ug	EUR 308.4
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 525 Sequence: ATGACCCACTGTTGCTCCCCTTGCTGTCAGCCTACATGCTGCAGGACCACCTGCTGCAGGACCACCTGCTGGAAGCCCACCACTGTGACCACCTGCAGCAGCACATCCTGCTGCCAGCCCGCCTGCTGTGTGTCCAGCTGCTGCCAGCCTTGCTGCCGCCCAACTTCCTGTCAAAA Show more
Description: A cloning plasmid for the KRTAP9-2 gene.

KRTAP9-2 cloning plasmid
CSB-CL880139HU2-10ug	Cusabio	10ug	EUR 308.4
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 525 Sequence: atgacccactgttgctccccttgctgtcagcctacctgctgcaggaccacctgctgcaggaccacctgctggaagcccaccactgtgaccacctgcagcagcacaccctgctgccagcccgcctgctgtgtgtccagctgctgccagccttgctgccgcccaacttgctgtcaaaa Show more
Description: A cloning plasmid for the KRTAP9-2 gene.

KRTAP12-2 cloning plasmid
CSB-CL012606HU-10ug	Cusabio	10ug	EUR 279.6
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 441 Sequence: ATGTGTCATACCAGCTGCTCCTCGGGCTGCCAGCCAGCCTGCTGCGCGCCCAGCCCCTGCCAGCCAGCCTGTTGTGTGCCCAGCTCCTGCCAGGCATCCTGCTGTGTGCCTGTGGGCTGCCAGTCCTCCGTGTGTGTGCCCGTGAGCTTCAAGCCAGCCGTGTGCCTGCCCGTGAG Show more
Description: A cloning plasmid for the KRTAP12-2 gene.

KRTAP4-2 cloning plasmid
CSB-CL861178HU-10ug	Cusabio	10ug	EUR 279.6
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 411 Sequence: ATGGTCAACTCCTGTTGTGGCTCTGTGTGCTCTGACCAGGGCTGTGGCCTAGAGAACTGCTGCCGTCCCAGCTGCTGCCAGACCACCTGCTGCAGGACCACCTGCTGCCGCCCCAGCTGCTGTGTGTCCAGCTGCTGCAGACCGCAGTGCTGCCAGTCTGTGTGCTGCCAGCCCAC Show more
Description: A cloning plasmid for the KRTAP4-2 gene.

Recombinant Human IGF-2/ IGF-II Protein, Untagged, E.coli-10ug
QP5264-10ug	EnQuireBio	10ug	EUR 163.2

Recombinant Dengue Virus Dengue Envelope-2 Protein, Untagged, Insect-10ug
QP11626-10ug	EnQuireBio	10ug	EUR 241.2

Recombinant Human Talin-2 Protein, His, Yeast-10ug
QP8291-ye-10ug	EnQuireBio	10ug	EUR 283.2

Recombinant Chicken Vitellogenin-2 Protein, His, E.coli-10ug
QP8859-ec-10ug	EnQuireBio	10ug	EUR 391.2

Recombinant Mouse Renin-2 Protein, His, E.coli-10ug
QP8886-ec-10ug	EnQuireBio	10ug	EUR 326.4

Recombinant Human Metallothionein-2 Protein, GST, E.coli-10ug
QP8894-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human Semenogelin-2 Protein, His, Yeast-10ug
QP9386-ye-10ug	EnQuireBio	10ug	EUR 369.6

Recombinant Bovine FGF 2 Protein, Untagged, E.coli-10ug
QP10599-EC-10ug	EnQuireBio	10ug	EUR 186

Recombinant Mouse Arginase-2, His-SUMO, E.coli-10ug
QP5677-ec-10ug	EnQuireBio	10ug	EUR 326.4

Recombinant Mouse Bcl-2 Protein, His, E.coli-10ug
QP5710-ec-10ug	EnQuireBio	10ug	EUR 186

Recombinant Mouse Thrombospondin-2 Protein, His, E.coli-10ug
QP6786-ec-10ug	EnQuireBio	10ug	EUR 326.4

Recombinant Mouse Thrombospondin-2 Protein, His, Yeast-10ug
QP6786-ye-10ug	EnQuireBio	10ug	EUR 326.4

Recombinant E.coli Thioredoxin-2 Protein, His, Yeast-10ug
QP7012-ye-10ug	EnQuireBio	10ug	EUR 434.4

Recombinant Human Hyaluronidase-2 Protein, His, Yeast-10ug
QP9753-ye-10ug	EnQuireBio	10ug	EUR 283.2

Recombinant Human Ficolin-2 Protein, His, Yeast-10ug
QP9759-ye-10ug	EnQuireBio	10ug	EUR 283.2

Recombinant Zebrafish Metallothionein-2 Protein, His, Yeast-10ug
QP9826-ye-10ug	EnQuireBio	10ug	EUR 434.4

Recombinant Human Plastin-2 Protein, His, Yeast-10ug
QP6289-ye-10ug	EnQuireBio	10ug	EUR 283.2

Recombinant Human Galectin-2 Protein, GST, E.coli-10ug
QP6295-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human Metaxin-2 Protein, GST, E.coli-10ug
QP6393-ec-10ug	EnQuireBio	10ug	EUR 326.4

Recombinant Human Twinfilin-2 Protein, GST, E.coli-10ug
QP7777-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human Prohibitin-2 Protein, GST, E.coli-10ug
QP8027-ec-10ug	EnQuireBio	10ug	EUR 240

pDONR223-CD73 Plasmid
PVTB00480-2	Lifescience Market	2 ug	EUR 427.2

Recombinant Human CCL24/ Eotaxin-2/ MPIF-2 Protein, His, E.coli-10ug
QP8522-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human Bcl 2 (minus BH4 domain) Protein, His, E.coli-10ug
QP11138-10ug	EnQuireBio	10ug	EUR 241.2

Recombinant Human 2-5A-dependent ribonuclease Protein, His-SUMO, E.coli-10ug
QP6997-10ug	EnQuireBio	10ug	EUR 186

Recombinant Human SerpinB2/ PAI-2 Protein, Untagged, E.coli-10ug
QP10161-ec-10ug	EnQuireBio	10ug	EUR 348

Recombinant Human TIMP2/ TIMP-2 Protein, Untagged, E.coli-10ug
QP10162-ec-10ug	EnQuireBio	10ug	EUR 348

Recombinant Human CCL8/ MCP-2 Protein, Untagged, E.coli-10ug
QP10231-ec-10ug	EnQuireBio	10ug	EUR 348

Recombinant Human IL2/ Interleukin-2 Protein, Untagged, E.coli-10ug
QP10309-ec-10ug	EnQuireBio	10ug	EUR 184.8

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-10ug
QP10390-ec-10ug	EnQuireBio	10ug	EUR 184.8

Recombinant Human Thioredoxin reductase 2, His-SUMO, E.coli-10ug
QP8200-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human Talin-2 Protein, His-SUMO, E.coli-10ug
QP8291-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug
QP8512-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Human TIMP2/ TIMP-2 Protein, GST, E.coli-10ug
QP8571-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant Mouse CXCL2/ MIP-2 Protein, His, E.coli-10ug
QP8651-ec-10ug	EnQuireBio	10ug	EUR 326.4

Recombinant Human Glutamate carboxypeptidase 2 Protein, His, E.coli-10ug
QP8726-ec-10ug	EnQuireBio	10ug	EUR 240

Recombinant E.coli GTP cyclohydrolase-2 Protein, His, E.coli-10ug
QP8879-ec-10ug	EnQuireBio	10ug	EUR 391.2

Small-scale GMP manufacturing of plasmid DNA utilizing a simplified and totally disposable manufacturing methodology

Operate and distribution of the conjugative plasmid pLM1686 in foodborne Listeria monocytogenes in China

Intramuscular Expression of Plasmid-Encoded FVII-Fc Immunoconjugate for Tumor Immunotherapy by Concentrating on Tumoral Blood Vessels and Cells

Enterococcal PrgU Offers Further Regulation of Pheromone-Inducible Conjugative Plasmids

Recombinant Human Non-specific lipid-transfer protein Protein, GST, E.coli-10ug

SARS-CoV-2 Nucleocapsid Protein, Avi-His-tag

Recombinant SARS-CoV-2 Spike Glycoprotein(S) (D614G), Partial

SARS-CoV-2 Spike S1 RBD Protein, Avi-His-tag

SARS-CoV-2 Spike S1 RBD Protein, Mouse Fc-fusion

SARS-CoV-2 Spike S1 (16-685) Protein, Avi-His-tag

SARS-CoV-2 Spike S1 RBD (V367F) Protein, Avi-His-tag

SARS-CoV-2 Spike S1 (13-665) Protein, Fc Fusion, Avi-tag

SARS-CoV-2 Spike S1 (16-685) Protein, Fc Fusion, Avi-tag

SARS-CoV-2 Spike S1 RBD Protein, Human Fc-Fusion, Avi-Tag

pLenti-CARM1 shRNA-2 Plasmid

pLenti-CTLA4 shRNA-2 Plasmid

pLenti-FOXM1 shRNA-2 Plasmid

pLenti-JUN shRNA-2 Plasmid

pLenti-LHX6 shRNA-2 Plasmid

pLenti-MAGEA3 shRNA-2 Plasmid

pLenti-RUNX3 shRNA-2 Plasmid

pLenti-Slc7a11 shRNA-2 Plasmid

pLenti-STAT3 shRNA-2 Plasmid

pLenti-XRCC5 shRNA-2 Plasmid

Recombinant Transmembrane Protease Serine 2 Protein, Partial

Recombinant Porcine IL 2 Protein, Untagged, E.coli-10ug

Recombinant Canine MCP 2 Protein, Untagged, E.coli-10ug

Recombinant Human BMP-2 Protein, Untagged, E.coli-10ug

Recombinant HIV-2 Protease Protein, Untagged, E.coli-10ug

Recombinant Human Glutaredoxin-2, GST, E.coli-10ug

Recombinant Human Arginase-2, GST, E.coli-10ug

Recombinant Human CXCL2/ MIP-2 Protein, Untagged, E.coli-10ug

Recombinant Influenza Parainfluenza Type-2 Protein, Untagged, E.coli-10ug

Recombinant Human STC 2 Protein, Untagged, HEK 293-10ug

Recombinant Bovine FGF 2 Protein, Untagged, Native Protein-10ug

Recombinant Human MMP-2 Protein, His, HEK 293-10ug

Recombinant Mouse MCP-2/ CCL8 Protein, Untagged, E.coli-10ug

ACE2, His-Tag Protein

KRTAP3-2 cloning plasmid

KRTAP9-2 cloning plasmid

KRTAP9-2 cloning plasmid

KRTAP12-2 cloning plasmid

KRTAP4-2 cloning plasmid

Recombinant Human IGF-2/ IGF-II Protein, Untagged, E.coli-10ug

Recombinant Dengue Virus Dengue Envelope-2 Protein, Untagged, Insect-10ug

Recombinant Human Talin-2 Protein, His, Yeast-10ug

Recombinant Chicken Vitellogenin-2 Protein, His, E.coli-10ug

Recombinant Mouse Renin-2 Protein, His, E.coli-10ug

Recombinant Human Metallothionein-2 Protein, GST, E.coli-10ug

Recombinant Human Semenogelin-2 Protein, His, Yeast-10ug

Recombinant Bovine FGF 2 Protein, Untagged, E.coli-10ug

Recombinant Mouse Arginase-2, His-SUMO, E.coli-10ug

Recombinant Mouse Bcl-2 Protein, His, E.coli-10ug

Recombinant Mouse Thrombospondin-2 Protein, His, E.coli-10ug

Recombinant Mouse Thrombospondin-2 Protein, His, Yeast-10ug

Recombinant E.coli Thioredoxin-2 Protein, His, Yeast-10ug

Recombinant Human Hyaluronidase-2 Protein, His, Yeast-10ug

Recombinant Human Ficolin-2 Protein, His, Yeast-10ug

Recombinant Zebrafish Metallothionein-2 Protein, His, Yeast-10ug

Recombinant Human Plastin-2 Protein, His, Yeast-10ug

Recombinant Human Galectin-2 Protein, GST, E.coli-10ug

Recombinant Human Metaxin-2 Protein, GST, E.coli-10ug

Recombinant Human Twinfilin-2 Protein, GST, E.coli-10ug

Recombinant Human Prohibitin-2 Protein, GST, E.coli-10ug

pDONR223-CD73 Plasmid

Recombinant Human CCL24/ Eotaxin-2/ MPIF-2 Protein, His, E.coli-10ug

Recombinant Human Bcl 2 (minus BH4 domain) Protein, His, E.coli-10ug

Recombinant Human 2-5A-dependent ribonuclease Protein, His-SUMO, E.coli-10ug

Recombinant Human SerpinB2/ PAI-2 Protein, Untagged, E.coli-10ug

Recombinant Human TIMP2/ TIMP-2 Protein, Untagged, E.coli-10ug

Recombinant Human CCL8/ MCP-2 Protein, Untagged, E.coli-10ug

Recombinant Human IL2/ Interleukin-2 Protein, Untagged, E.coli-10ug

Recombinant Human IGF1 Isoform 2 Protein, Untagged, E.coli-10ug

Recombinant Human Thioredoxin reductase 2, His-SUMO, E.coli-10ug

Recombinant Human Talin-2 Protein, His-SUMO, E.coli-10ug

Recombinant Human Angiopoietin-2/ ANG2 Protein, His, E.coli-10ug

Recombinant Human TIMP2/ TIMP-2 Protein, GST, E.coli-10ug

Recombinant Mouse CXCL2/ MIP-2 Protein, His, E.coli-10ug

Recombinant Human Glutamate carboxypeptidase 2 Protein, His, E.coli-10ug