Purified Native dsDNA, calf thymus

purified native dsDNA

In an attempt to notice notion into their excellent binding properties, we investigated the cross-reactivity of RH14 and B3 to 7 expert DNA-binding proteins (DNA polymerases and DNA-repair enzymes), along with three non-specific (not requiring a selected sequence or measurement of DNA for binding) and four specific DNA-binders. All three of the nonspecific DNA-binders, nonetheless not one of many specific DNA-binders, exhibited binding to the bogus oligonucleotide and, in flip, comparable binding to autoantibodies, throughout the robust half (S. Kumar et al., unpublished observations). Thought of one in all these molecules presently described –Escherichia coli PolIV – is guide of the enzymes studied, and is a member of the newly labeled Y-family of DNA polymerases.

ABSTRACT

Whereas immunoglobulin G (IgG) antibodies to double-stranded (ds)DNA are serological markers of systemic lupus erythematosus (SLE), not all antibodies to DNA (anti-DNA) are ready to set off tissue damage to an similar extent. It has been proposed that anti-DNA-induced renal damage might very nicely be linked to variations throughout the excellent specificity of the antibodies. In an attempt to notice notion into their excellent binding properties, we investigated the cross-reactivity of two human lupus monoclonal IgG anti-dsDNA (B3 and RH14) to a recently described Escherichia coli PolIV (a DNA polymerase).

  • These autoantibodies possess distinct pathogenic properties in excessive blended immunodeficient (SCID) mice. Although every antibodies set off proteinuria, solely RH14 induces early histological choices of lupus nephritis. Every RH14 and B3 positive PolIV; nonetheless, they exhibited a marked distinction of their reactivity to the PolIV–dsDNA sophisticated.
  • Alhough RH14 exhibited essential train to the sophisticated, the binding of B3 to PolIV complexed with dsDNA was practically abolished. Furthermore, there was a essential distinction in one of the simplest ways the lupus sera acknowledged naked dsDNA and that provided on PolIV.
  • Although 67% of lupus sera positive naked dsDNA, ≈ 90% of these sera (93% calf thymus DNA; 90% synthetic oligonucleotide) reacted to the sophisticated when dsDNA was provided on PolIV. Thus, the IgG anti-dsDNA extra prone to exist in lupus victims is also distinguished into individuals who acknowledge dsDNA throughout the context of PolIV and folks which do not. This distinction in binding functionality would possibly help to inform aside these dsDNA antibodies which will be additional pathogenic.

INTRODUCTION

Systemic lupus erythematosus (SLE) is an autoimmune rheumatic sickness affecting principally ladies all through their childbearing years. Immunoglobulin G (IgG) antibodies to double-stranded (ds)DNA are serological markers of SLE that normally replicate sickness train12 and are fastidiously associated to its pathogenesis.3 These antibodies are considered to be specific for lupus as they’re infrequently current in numerous sickness circumstances.

 Nonetheless, every medical and animal model analysis clearly current that not all antibodies to DNA (anti-DNA) are equally ready to set off tissue damage in SLE. Anti-DNA-induced renal damaging functionality might very nicely be linked to variations of their excellent specificities (reviewed in ref. 5). By using two prototypic human monoclonal antibodies (mAbs) (B3 and RH14) on the market in our laboratory, we investigated the properties that make an anti-DNA pathogenic. These antibodies have been derived from victims with lupus, who had attribute sickness manifestations and possessed distinct and quite a few pathogenic properties.

purified native dsDNA

purified native dsDNA

In excessive blended immunodeficient (SCID) mice, although every types of antibodies set off proteinuria, solely RH14 induces early histological choices of lupus nephritis detectable by electron microscopy.

These polymerases present poor processivity, low fidelity, lack any detectable proofreading train and are involved throughout the bypass of numerous DNA lesions that stall the precept replicative polymerase.9 PolIV has been confirmed to extend misaligned primer–template termini.10 PolIV is a well-characterized protein812 with its homologues representing key enzymes of numerous pathogenic genera, along with BacillusStaphylococcusEnterococcusStreptococcusMycobacteriumBordetellaNeisseriaEscherichiaKlebsiellaLegionellaPasteurellaPseudomonasSalmonellaYersiniaTreponemaPlasmodium and Trypanosoma.13 Newest advances embody the invention that PolIV is a selected error-prone DNA polymerase required for adaptive stage mutation.

 

Individuals possess three Y-family polymerases, along with a DinB homologue, now designated PolKappa.12 As bacterial an an infection has been implicated beforehand as one in all many causative brokers for autoimmune sickness (reviewed in ref. 14), PolIV is of express curiosity as, together with being of bacterial origin, PolIV homologues have been proposed to contribute to adaptive strategies of pathogens, along with antigenic variation.

 

Furthermore, PolIV could be overexpressed in E. coli, purified to homogeneity and, most importantly, is able to retain its attribute DNA-binding functionality when positive in a robust half. Antibodies to DNA-binding proteins associated to DNA metabolism have been confirmed to occur in lupus sera.15 It is recognized that antibodies directed to such autoantigens acknowledge conformation-dependent epitopes that symbolize energetic web sites and purposeful space areas.

 

We have recently purified PolIV to homogeneity and have optimized the circumstances that allow the enzyme to comprehend its proper conformation when positive in a robust half. The worthwhile adaptation of these circumstances in enzyme-linked immunosorbent assays (ELISAs) allowed us to carry out the present investigations.

 

We now present that two distinct populations of IgG anti-DNA exist in lupus victims – the inhabitants that acknowledges dsDNA throughout the context of PolIV may be very prevalent in lupus sera. We moreover present that absolutely completely different subsets of lupus autoantibodies acknowledge qualitatively completely completely different DNAs (calf thymus or synthetic oligonucleotide) provided on PolIV, in any other case.

 

AMHR2 Antibody

1-CSB-PA311389
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AMHR2. Recognizes AMHR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

AMHR2 Conjugated Antibody

C36093 100ul
EUR 397

Anti-AMHR2 Antibody

PB9984 100ug/vial
EUR 334

Anti-AMHR2 antibody

STJ28606 100 µl
EUR 277
Description: This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-AMHR2 antibody

STJ73109 100 µg
EUR 359

AMHR2 siRNA

20-abx900305
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AMHR2 siRNA

20-abx907380
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AMHR2 siRNA

20-abx907381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AMHR2 cloning plasmid

CSB-CL614985HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1722
  • Sequence: atgctagggtctttggggctttgggcattacttcccacagctgtggaagcacccccaaacaggcgaacctgtgtgttctttgaggcccctggagtgcggggaagcacaaagacactgggagagctgctagatacaggcacagagctccccagagctatccgctgcctctacagcc
  • Show more
Description: A cloning plasmid for the AMHR2 gene.

AMHR2 Rabbit pAb

A6523-100ul 100 ul
EUR 308

AMHR2 Rabbit pAb

A6523-200ul 200 ul
EUR 459

AMHR2 Rabbit pAb

A6523-20ul 20 ul
EUR 183

AMHR2 Rabbit pAb

A6523-50ul 50 ul
EUR 223

Polyclonal AMHR2 Antibody (C-term)

AMM08579G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMHR2 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal AMHR2 Antibody (N-term)

APR14286G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMHR2 (N-term). This antibody is tested and proven to work in the following applications:

Anti-AMHR2 (aa88-99) antibody

STJ73110 100 µg
EUR 359

Polyclonal AMHR2 / MISRII Antibody (aa207-440)

APR14922G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMHR2 / MISRII (aa207-440). This antibody is tested and proven to work in the following applications:

Polyclonal AMHR2 Antibody (N-term R80)

APR14923G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMHR2 (N-term R80). This antibody is tested and proven to work in the following applications:

Polyclonal AMHR2 Antibody - N-terminal region

APR14924G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AMHR2 - N-terminal region. This antibody is tested and proven to work in the following applications:

AMHR2 ELISA KIT|Human

EF004620 96 Tests
EUR 689

Rat AMHR2 shRNA Plasmid

20-abx985564
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AMHR2 shRNA Plasmid

20-abx950184
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AMHR2 shRNA Plasmid

20-abx980084
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AMHR2 Recombinant Protein (Human)

RP046534 100 ug Ask for price

AMHR2 Recombinant Protein (Mouse)

RP115586 100 ug Ask for price

AMHR2 Recombinant Protein (Rat)

RP190055 100 ug Ask for price

Recombinant Human AMHR2 Protein

VAng-3015Lsx-200g 200 µg
EUR 2374
Description: Recombinant Human MIS RII (AMHR2) protein was expressed in E. coli. (Uniprot ID: Q16671)

Polyclonal Goat Anti-AMHR2 Antibody (internal region)

APR16202G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AMHR2 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-AMHR2 Antibody (internal region)

APR16203G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AMHR2 (internal region). This antibody is tested and proven to work in the following applications:

Amhr2 ORF Vector (Rat) (pORF)

ORF063353 1.0 ug DNA
EUR 506

AMHR2 ORF Vector (Human) (pORF)

ORF015512 1.0 ug DNA
EUR 405

Amhr2 ORF Vector (Mouse) (pORF)

ORF038530 1.0 ug DNA
EUR 506

Leave a Reply

Your email address will not be published. Required fields are marked *

Related Post

heraeus-targets

Molecular Characterisation of Plasmids Encoding bla CTX-M from Faecal Escherichia coli in Travellers Returning to the UK from South AsiaMolecular Characterisation of Plasmids Encoding bla CTX-M from Faecal Escherichia coli in Travellers Returning to the UK from South Asia

Background: The worldwide prevalence of ESBL-producing Escherichia coli is rising and is dominated by blaCTX-M unfold by plasmids. Travellers to South Asia from Western Europe have excessive charges of acquisition of faecal